For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:34333265+34333384 120bp GGGTTCATGTATCCACAGCAC GGGCAAACTCTTCCTGGTTATAG
Mut = 112 bp
Wt = 120 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AGTTCCTTTCACTGACTGCCATTCTGGAGCATTGTCTGTCCTCACAGACATCCTGTCATTGGGTTCATGTATCCACAGCACGTTTTCTGGAGCAGTtgaaggctgagtgtcactacttcaatgggaaggagcgtgtgtggagtgtgaccagattcatctataaccaggaagagtttgcccgctttaacagtgactttgggaagttcctggcagtgactgagctggggcggcccatagttgagtacttgaacacccagaaggacatgctggacaattatcgtgcctcagtagacaggtgcagaaataactatgacCTTGTGGATATCTTCATGTTGAACTTAAAAGGTAAGCATTAGATAGAGAGTAGATGGGTT
This mutation is a 218 bp deletion beginning at Chromosome 17 position 34,333,301 bp and ending after 34,333,518 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49725 | GGG TTC ATG TAT CCA CAG CAC | Common | A | |||
| 49726 | GGG CAA ACT CTT CCT GGT TAT AG | Wild type Reverse | A | |||
| 49727 | CAC ACA CAC ACA CCT CAA CC | Mutant Reverse | A | |||
| 49728 | Fluorophore-1 | AAT GGG AAG GAG CGT GTG TG | Quencher-1 | WT Probe | ||
| 49729 | Fluorophore-2 | CTG GAG CAG TCT TGT GGA TAT CTT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49725 | 0.40 uM |
| 49726 | 0.40 uM |
| 49727 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.