Protocol 36792: Probe Assay - Cttnbp2nl<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr3:105003984-105004116 133bp ATGCCAGCTTTGTGTTCTGA AGCACCCCAACTGCTAAGTG

Mut = 135 bp

Wt = 133 bp

Fam = Mut

Hex = Wt

Sequence

MUT Sequence (junction in uppercase:

ccctgagtgatcgtaattgttagtacatccttctgttttccttctctaatcaagaGGgagtgtgtgatatacggagcacttgattgagtttttgagaaactcggcctcgatggcag

 

This mutation is a 4285 bp deletion beginning at Chromosome 3 position 105,001,869 bp and ending after 105,006,153 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49719 ATG CCA GCT TTG TGT TCT GA Wild type Forward A
49720 AGC ACC CCA ACT GCT AAG TG Wild type Reverse A
49721 ACC AGA GAG CAG CCA GTG AG Mutant Forward A
49722 ATC GAG GCC GAG TTT CTC Mutant Reverse A
49723 Fluorophore-1 CTG AAG GGC GGG AAC TCT GT Quencher-1 WT Probe
49724 Fluorophore-2 CAA GAG GGA GTG TGT GAT ATA CGG AG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
49719 0.40 uM
49720 0.40 uM
49721 0.40 uM
49722 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.