Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr3:105003984-105004116 133bp ATGCCAGCTTTGTGTTCTGA AGCACCCCAACTGCTAAGTG
Mut = 135 bp
Wt = 133 bp
Fam = Mut
Hex = Wt
MUT Sequence (junction in uppercase:
ccctgagtgatcgtaattgttagtacatccttctgttttccttctctaatcaagaGGgagtgtgtgatatacggagcacttgattgagtttttgagaaactcggcctcgatggcag
This mutation is a 4285 bp deletion beginning at Chromosome 3 position 105,001,869 bp and ending after 105,006,153 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49719 | ATG CCA GCT TTG TGT TCT GA | Wild type Forward | A | |||
| 49720 | AGC ACC CCA ACT GCT AAG TG | Wild type Reverse | A | |||
| 49721 | ACC AGA GAG CAG CCA GTG AG | Mutant Forward | A | |||
| 49722 | ATC GAG GCC GAG TTT CTC | Mutant Reverse | A | |||
| 49723 | Fluorophore-1 | CTG AAG GGC GGG AAC TCT GT | Quencher-1 | WT Probe | ||
| 49724 | Fluorophore-2 | CAA GAG GGA GTG TGT GAT ATA CGG AG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49719 | 0.40 uM |
| 49720 | 0.40 uM |
| 49721 | 0.40 uM |
| 49722 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.