For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:89189870-89189960 91bp ACCTTCCAGGGGTCTTGGAG TTCTGAAAGTGGGCTGATCC
Mut = 108 bp
Wt = 120 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AAGCTGCAGTAAGGTAGCCAGGTTCTCTAAAGCCCATGGATAGCCATATATCTGCGCAATCTGGCCTCCTTGACGCCATGACAGCAGCTGACCCGTGAGCACTGTGTAGTGGATTCTCCTGTCCCAGGCAGACTGAGTCAGGCTCcttcagggaaactgaaagtgattctctgtgttgattcatccaaggcccatgtgttgtctgcaggatcaggctaggagtctgctgggaaatagatcctcaagtctgtttgcccttgatcggatatttgtgccaacaaaggccagcccggtgcacccttgtaccacagccctcagccctgacaatgggaggagattctcccactgtgacttgtatggtgggactgcctctttccagggtgcctgggagacactcagttcagtttccgtatgcgtcagtgtgggggacaaaggagcctctggcaggtggatgatcggtcgtataacaacaaggcccccttggcattgcaggtaagtagtggggtgtctctctggtctgtgtcttctctcccttggtggggggctcctggctgtgaacctgagctttgtgtgatggaagtgctggccaggctcatcctgagaggtcaatgacagttgcaggtcctgctgattctgtcttggggttctccacctaggccagctcttatggggttcaccaggatcactgaagttgattctgtgcacccgatttcccttgctgggcatctgtgtggctaaataagctgtggttcaatgagcaaaacccggagggaccttccaggggtcttggagcactctcagattggctaaattcttTCTGAATCAGCAGATGTCCTCTAGACCGGATCAGCCCACTTTCAGAACTAGGGAATCCTAAGTCTCACTGTGCTAGGCAGAGGGCAGGCCCTAGTCTCAGGGGCAAGTGCCTCCTAGGGTCTCCTAGATTCTTAGACCCCACACATATACCCTTTCCTTT
This mutation is a 571 bp deletion beginning at Chromosome 15 position 89,189,967 bp and ending after 89,190,537 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49651 | TTC TGA AAG TGG GCT GAT CC | Common | A | |||
| 49652 | CTG TGG TTC AAT GAG CAA AAC | Wild type Forward | A | |||
| 49653 | GAC CCG TGA GCA CTG TGT AG | Mutant Forward | A | |||
| 49654 | Fluorophore-1 | AGG GAC CTT CCA GGG GTC TTG | Quencher-1 | WT Probe | ||
| 49655 | Fluorophore-2 | AGG CAG ACT GAG TCA GGC TCT CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49651 | 0.40 uM |
| 49652 | 0.40 uM |
| 49653 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.