For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:30974467+30974567 101bp GGCAAACCTCAGTCAAAGGA TTTGCCACTCAGACCCTTG
Mut = 93 bp
Wt = 101 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CAGAGAGGGAAGAAAGGGAAAGTGGGGAGGGAGGAGGAGAGAAGGGTGGAGAGGTGGAAAGGAGAAGAGGAATTGATGGGAAAGGGAGAAAAGAAGGAGGGAAGCAGAAAGGAGGAGAGGGAGAAAGTGGAAGGGTGGAATTCGGGGAGGAAAAAGAGGGGAGgggtaaagaggatacagtcggttagagtcacagtagatgttgcccaagagtccacagcggtcagggatcagcaccaggtcaagaggcaaacctcagtcaaaggactgcatctagccaggagtgcccgccttattaagatttctcacaggtcagagctttggggtcccaagggtctgagtggcaaattgatttgcaaactcacaagacccccatattatagaaacgactgctatctacagcccataagccctaaggtttgaaggtaccctcctgtggactctggagatggccagctgaactgaagcagacatATCCCTGTGGCTTCCTCTGTAGCAGGAACGAAGGACAGTGATCTTCAGCAGAGGATAATGGCAGAAGCATAGGGTCTACCTGTGGTTGTGTTGCCATGACTGTGGAGAGAAGTAGCTACGGGGTGCCCATTATCTAAGACCAATAACAGCCTAACCTTTCTAATGCTGAGACCCTTTAATACA
This mutation is a 211 bp deletion beginning at Chromosome 13 position 30,974,433 bp and ending after 30,974,643 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49634 | GGC AAA CCT CAG TCA AAG GA | Wild type Forward | A | |||
| 49635 | TTT GCC ACT CAG ACC CTT G | Wild type Reverse | A | |||
| 49636 | AGG AGG GAA GCA GAA AGG AG | Mutant Forward | A | |||
| 49637 | TGC TAC AGA GGA AGC CAC AG | Mutant Reverse | A | |||
| 49638 | Fluorophore-1 | CTA GCC AGG AGT GCC CGC | Quencher-1 | WT Probe | ||
| 49639 | Fluorophore-2 | AAG TGG AAG GGT GGA ATT CGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49634 | 0.40 uM |
| 49635 | 0.40 uM |
| 49636 | 0.40 uM |
| 49637 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.