For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:105250481-105250588 108bp ATTTCCCTTTACTACCTGTAGGC GGAACATTTTGGAGTGCTGA
Mut = 105 bp
Wt = 108 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CATTTGCCGTCCTGTCTGCTAATCAGAACACAGAAGGCTAGCCTTTTCAGTAGCAGAAATGAAATGTGCATGTGATCGGCTTTTTTGTTTTTTTTTTTTCTAAACCCATTCTCTGGTCACTTTACAATGACAGCATTGTCTTTATTTCCCTTTACTACCTGTAGGCCCagtggacagttgggaaactgaattgtcctttctgtggggcccgattagggggctttaattttgtcagcactccaaaatgttcctgtggccagcttgcagctgtacatctctgcaagagccggactgatcaccaagcagcacagggagggagactaatgagaccagcgctgaaacatttgccacatcccggagtcccgtcaggttgtgataaggaaactctgctgacaggtggtggctccaaaaccagaaaccactggcttttaagcatggcccgaaacagtaacggcctcggaagacttacagaagcactctgcctggaggtgcgagcgacgtattttgagatgaagaatgaaaaactgctcttcaaagcctcggacccaaaatgccagccttttgttcctcagcctgacaccggcaggtgtccttcaagagcgtctcacagaaagtcacacagtttggacctgaacatcagtgagaagctgattttattacccactttatatgaaatacatcgtaagcctactgcctatcccaggctaaatgaaacggggcccattgacctttcaggcttggctttaccgtgtagtaacagtagctgctcctttcaaagcccacctagttttgatccgaatatgctgctgcacagactttcagtggctccccatgagacccaggcacaaaggggaagagaatgccagtgcggcctagaagcttcttcagtctactcggatcacgctaacgctaacagcctgccattcctgatggatctgccctcagcagggaggagcgtgctggaggcctcggaccaagaggagcacctctcccagctggacttcctgcgctctgccagcttccccttgggcaccattaaccacaggctgaacaacagggagagaagcaagttgaggactctgcgaaggcagcagaggcgcgaacgatggctacagaagcagGTAAGCGCTTTGCAACCAGTTTAGCAAGAAATAGTGTCCCTAAGTACTGGGGTCTGTGGCACAGAGGTCAATGTGAATGTACGCATTCTGAAATCTTAGTCTTAAGTTATGAGATGATGTGTCAGTCTGTGT
This mutation is a 953 bp deletion beginning at Chromosome 13 position 105,249,611 bp and ending after 105,250,563 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49607 | ATT TCC CTT TAC TAC CTG TAG GC | Common | A | |||
| 49608 | GGA ACA TTT TGG AGT GCT GA | Wild type Reverse | A | |||
| 49609 | CAT TCA CAT TGA CCT CTG TGC | Mutant Reverse | A | |||
| 49610 | Fluorophore-1 | CTG TGG GGC CCG ATT AGG | Quencher-1 | WT Probe | ||
| 49611 | Fluorophore-2 | CGC TTT GCA ACC AGT TTA GCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49607 | 0.40 uM |
| 49608 | 0.40 uM |
| 49609 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.