For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:30060842+30060967 126bp GCTTTGCTGGTAAGTGCAGA TGCAAAATCCAAAGGAGAGC
Mutant= 98 bp
Wild Type = 126 bp
Sequence
Wt Sequence (deletions in lower case):
TACTGTTCCCAGTTGTAAACCGCAGCAAATAAAACAAGACATTGGCTCATGCAAAGGTAAAAGAAAACCCATGCAGCTTACTTTAGTTTTGTTTGCTTTTGTTTTGTTGGGGGTGGGATAGACAGACAGCTGGCCAGACTTGTTCTTAGCTTATTAGTTCAgttgtctggccagcaaattctttgcttgtatttaattttttgttttgattagaatgatacagaattttttagctcttctttctttcttttctttcttttcttttttctttcttttttcttttcttttcttttcttttttttttttttgccccaggtccagcaagactatgaatctctgttccaaatgctttgctggtaagtgcagaaaagggtgtgggtgttttctgtgtccccccccccccaacgatttatttattttttctttttggttattttaagattaaattatttagctctcctttggattttgcatGGGGCTTTGTTATGTTTGTGCGTGAAAGCAGATTCTCTTCACTGGGCGCTTCATATATTTGCTTAAGATTGCTAAACTCATCTCTGAGGGAAATGAAGTTTCATGTGTACTTGCATCAAATCCAATTTGCTAAGCTCTTGGGGTACAGAGGAATTATAAAAAACATGTCTGGTTTAGTAGGGTCCTGTTTATT
A 313 bp deletion beginning at Chromosome 17 position 30,060,656 bp and ending after 30,060,968 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49692 | GCT TTG CTG GTA AGT GCA GA | Wild type Forward | A | |||
| 49693 | TGC AAA ATC CAA AGG AGA GC | Wild type Reverse | A | |||
| 49694 | GGG TGG GAT AGA CAG ACA GC | Mutant Forward | A | |||
| 49695 | GCC CAG TGA AGA GAA TCT GC | Mutant Reverse | A | |||
| 49696 | Fluorophore-1 | CTT ATT AGT TCA GGG GCT TTG TTA TGT | Quencher-1 | MUT Probe | ||
| 49697 | Fluorophore-2 | TGT GGG TGT TTT CTG TGT CC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49692 | 0.40 uM |
| 49693 | 0.40 uM |
| 49694 | 0.40 uM |
| 49695 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.