For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:41355159+41355287 129bp GGTAACCCATCAAAATGTAGTCAC CCCAACATAGAGAGACTGTAGAGGA
Mutant= 106 bp
Wild Type = 129 bp
Sequence
Wt Sequence (deletions in lower case):
TGGTAACCCATCAAAATGTAGTCACATACAGAGTACTTTGCTACTGTAAATTTAAgataataatgtccagcataatgagaattttaactttcaatttaggagtattcctctacagtctctctatgttgggcaaacatttattttttcctacagggatacagtgttaccttcttgccttctttcttgccttctattattgcactctttaaggatgcctagtcagaggcctgaaggagtcaccttccagcaccttcatgaattttctcctcaatgatcttttttttttaattgaagttgctttccctgtggatgatgatgacaagatagttggaggatacacctgccgagagaattctgttccctaccaggtgtccctgaactctggctaccacttctgtggaggttccctcatcaatgaccagtgggtggtgtctgcagctcactgctacaagtcgtaagtggtggtccctaatGGTACAGAATTCAAATTTGGCCTTTCTGCAGACACAGTATAAGATCAGGCAAGA
A 418 bp deletion beginning at Chromosome 6 position 41,355,213 bp and ending after 41,355,630 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49687 | GGT AAC CCA TCA AAA TGT AGT CAC | Common | A | |||
| 49688 | CCC AAC ATA GAG AGA CTG TAG AGG A | Wild type Reverse | A | |||
| 49689 | TTG CCT GAT CTT ATA CTG TGT CTG | Mutant Reverse | A | |||
| 49690 | Fluorophore-1 | TGT CCA GCA TAA TGA GAA TTT TAA CTT | Quencher-1 | WT Probe | ||
| 49691 | Fluorophore-2 | TGC TAC TGT AAA TTT AAG GTA CAG AAT TCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49687 | 0.40 uM |
| 49688 | 0.40 uM |
| 49689 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.