For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:53595501-53595598 98bp TTGTGCTCGCCTGACAAG CAGCTGGAAAACACCATGAC
Mutant= 102 bp
Wild Type = 98 bp
Sequence
Wt Sequence (deletions in lower case):
GCTTTAGAATTTGCCTTAGTTTCTTTCTTCACCTCCCTCTGTATCCCTGTTGTATCCACACCTGCTCCTCCCTGCCCCCTCCCAGCCTCTGTGGATTTGTGGATTGAACCCAGGGCCTTGTGCTCGCCTGACAAGCACTCTATCACTGAGCCACACTCTTGTCCTGTCTTTCCGTTgtgccttaaattgtggtgtgtcatggtgttttccagctgctaaataactattcataagttgtctgggtatgaatgtttattaaatgaaagagaatttgagtatgcctatgctaatttttacctttttctgtcttgccaggaagtggttatagtaagtgctataagaactcccattggatccttcctgggcagccttgcctctcagccggccactaaacttggtactgctgcaattcagggagccattgagaaggcaggtcagtggttgaactgttttggtattgaggggacaaatgatgggtgacacatacttattttacatttgctgactatattcctcttagaaatGACATGATTCTTCCATATCTAAATGCCTTGTCATAGGTACACAGGAAGGAATCCAAAACTAACAGGAAAAAGAAACCATTCCTGTCTTGTGTCATGGAATTTGCTTGGTAATCTTGATTATATAAATTGA
A 348 bp deletion beginning at Chromosome 9 position 53,595,192 bp and ending after 53,595,539 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49587 | TTG TGC TCG CCT GAC AAG | Common | A | |||
| 49588 | CAG CTG GAA AAC ACC ATG AC | Wild type Reverse | A | |||
| 49589 | TGT GTA CCT ATG ACA AGG CAT TTA G | Mutant Reverse | A | |||
| 49590 | Fluorophore-1 | CGT TGT GCC TTA AAT TGT GGT | Quencher-1 | WT Probe | ||
| 49591 | Fluorophore-2 | CTG TCT TTC CGT TGA CAT GAT TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49587 | 0.40 uM |
| 49588 | 0.40 uM |
| 49589 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.