Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr9:27037322+27037410 89bp TAGCAGTTCAAAGGGTGAAGCA GCATGCCTGAATTGTTATTTC
Mut = 90 bp
Wt = 89bp
Fam = Mut
Hex = Wt
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
This mutation is a 494 bp deletion beginning at Chromosome 9 position 27,036,876 bp and ending after 27,037,369 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49346 | GCA TGC CTG AAT TGT TAT TTC | Common | A | |||
| 49347 | TAG CAG TTC AAA GGG TGA AGC A | Wild type Forward | A | |||
| 49348 | TGG AGC CCT TGA GAC TAC AG | Mutant Forward | A | |||
| 49349 | Fluorophore-1 | AAG GAA GAG CGT CAG ACA AAC CA | Quencher-1 | WT Probe | ||
| 49350 | Fluorophore-2 | ACA GGT GTT TCC TTA ATC TTT ATG ACA GCT | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49346 | 0.40 uM |
| 49347 | 0.40 uM |
| 49348 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.