For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:75230953+75231047 95bp TTGGGGTTCACTCTCTGCT TTCGTACAGATAGACCAAAACACC
Mut = 102 bp
Wt = 95 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CTAGCCAGCACATGGTATAAGGTGTTCTGTCTCCTGAATGGGTTAGGACACACATTATAAATCTGTAAAGTATTAGCTTCTATAAGTGAACTGAAAGATTGCCAACATTTTTGTTTTGTTATTGAGACATCTGTCTTTCAGATACTTTTAtcatgtcgtggaaattttcagaaataatttctaaagagctgctttgtcgttttcttttcaacatgatgcctcttctattcttcccacaggtttggttgtaaatgcatcaccaagaggcagcccagaatgaagaaagcaaacaggagtgctggctcagtgcctaaggtgtctgggataagcaaaccgcaaacagtagagaaaagcaagcctgagaacagctcttcagcacccacaggagtcaagcctgtgaggcctggggcagcagcagccttgtcaaaggtattcacgtagctgtatttgaatatgcagtggattttaggcatgtatttaaatatgttgaatttattaaatgaatataatttggggttcactctctgctagtactaggaacacagtctttgaggagatctttcagcagGGTAACCTTAATTGGTGTTTTGGTCTATCTGTACGAATGAAACTTAACAGTAGGCTCTGTATAAAGAAAATAACCAAGTGCCTGCTTTATACAGGGAATCATGTACAGGTGAGCCAGAGGTAGAGTCTGCCTTCAGGGAGTTTGAGA
This mutation is a 408 bp deletion beginning at Chromosome 10 position 75,230,598 bp and ending after 75,231,005 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49320 | TTC GTA CAG ATA GAC CAA AAC ACC | Common | A | |||
| 49321 | TTG GGG TTC ACT CTC TGC T | Wild type Forward | A | |||
| 49322 | GTG AAC TGA AAG ATT GCC AAC A | Mutant Forward | A | |||
| 49323 | Fluorophore-1 | TAC TAG GAA CAC AGT CTT TGA GGA GAT CT | Quencher-1 | WT Probe | ||
| 49324 | Fluorophore-2 | TGT TTT GTT ATT GAG ACA TCT GTC TTT CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49320 | 0.40 uM |
| 49321 | 0.40 uM |
| 49322 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.