Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr15:78919572+78919677 106bp CCATAGCCCACAAGAAAGGA CCTACAGGGAAAGGCCTCAG
Mut = 114 bp
Wt = 106 bp
Fam = Mut
Hex = Wt
MUT Sequence:
gcccgaagacaacatctctctcagcctctgtttttctcctagcaaccatctggcctacgtttttAAcattttgcccattgagcttttagcatctctgaggcctttccctgtagg
This mutation is a 5911 bp deletion beginning at Chromosome 15 position 78,913,713 bp and ending after 78,919,623 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49303 | CCT ACA GGG AAA GGC CTC AG | Common | A | |||
| 49304 | CCA TAG CCC ACA AGA AAG GA | Wild type Forward | A | |||
| 49305 | GCC CGA AGA CAA CAT CTC TC | Mutant Forward | A | |||
| 49306 | Fluorophore-1 | CCC ATC TCT GTG TCC TCA GCC | Quencher-1 | WT Probe | ||
| 49307 | Fluorophore-2 | AAC CAT CTG GCC TAC GTT TTT AAC ATT | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49303 | 0.40 uM |
| 49304 | 0.40 uM |
| 49305 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.