Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr7:28368736-28368836 101bp GTGCTTCGTGCAAAGAGTGA ATGGGAGTCAGCACCACCT
Mut = 100 bp
Wt = 101 bp
Fam = Mut
Hex = Wt
Wt Sequence (deletions in lower case):
GGCATTACCAACACCCCCTTTCCCAGGGCTGTGGTGTCACTCCCTAGGTCACGACATGCCAGCCATGCCAGGGTTATCAGGCTGAATAGTACGAAGCCGTGAGGAGGCAGAATTTCTGGGGTAGCCATCTGAGGCTCCTTCCTACCTGTCTGTTGCCCTCTggagtcttgtcatgggacaggggggcaggcaagccctttaccttcccctttgcccgcccacagtgagctcctggaggacttggaaggctgcagcagtgcagggggcatcgccgagtgcttcgtgcaaagagtgagtaggacagcttgaggctgggggacggacgctgggccgggattcatggggccatggggatctaggtggtgctgactcccatgtccccacagagcgaagattttgacatctatacattgtactgcatgaactacccaaggtgaggcaaagggagtccctgtttggcccccgggtattcccacgagccaatgtgccaaaccactaccccctaccctttaccgcccccaaccctgtgcccaggggcagccccttctagaccttgatagtcactggcctccttaactaccctgacctgatcatccctgaccctggccacctcctcccagccctgcctgctggagtgccagccaccactgatctatgctgtgccccccagctccctggccctgctccgagagctgtcagtgtccccgccagccactctgtggctacaggagcgtcaggcccagctccgtcactccctgcctctgcagagcttcttgctgaagcctgttcagcgcatcctgaagtaccatctcctgctgcaggtcagctgtgcccctgaggcctggcttgtggagagggggcatggttgggtctaacagccacccctggtaccctgactgtctgtggtctgcccctcccctttcatgttgctctgcctcctgtctcactcctcttttctctttttctcccccatccttctaccctgctggatgactgtcaggaactgggcaagcactgggcagagggcccagacagtggagggcgagagatggtggaggaagccattgtatccatgactgcagtggcctggtacatcaatgacatgaagcgcaagcaagagcatgctgcacgcctgcaggtggcccccggggtgggctggggcacctgagctgggggatgttgctcagtgtgtcccggtcactaacgcctctgttttggcttgtatatgtgtgccaccaacctgggcctgtctctatgcctgatgtggtcccagcaggaagtgcagcggaggctgggtggctggactggcccggagctcagcgcctttggagagctagtactggaaggcactttccgagggggaggcgggggaggccccaggcttcgtgggggtgagcgcctcctcttcttgttctcccggatgctgctggttgccaagcgtcgggggcctgaatacacctacaagggccacatctttgtgagtatagagtggggtctggctcagagagtcagaactaatgtatgttcccctgagttcccgaaaggggacagactggcttccaaggaccatatttagctgcgcccagtgacatttgacctttgattccagttactgggaaggctgagacaagaccaaaagttcaagactaacctgggctacagaaaaggttcaagaccagtcccgggcagcctgattaaaacaacattaacggctagaagtagGGCATGGTAGCTCACTGGGGAGGCAGGGGGGTTGAAGTAAAAGCCTGAGGCCAGTAAGACCGACAGGTGAGCTCAAGGCCAGCGTAGGTTATGTAGTGAGATCCTGTCTCAGGAGGGCACACTGATCTCCAGGTTCTAGGGTAACTAGGACTACAAAGAGAGCCAGACCCTGTCTCAAAACCCAGCCAAAAAAGCAACAGTGAGCGTAGCTGGTGGCCACAGGAACCAGTGTGTGAAGATGCCACAAACTTGTCCGCTGACCTCCACTGGCC
This mutation is a 1561 bp deletion beginning at Chromosome 7 position 28,367,390 bp and ending after 28,368,950 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49136 | GTG CTT CGT GCA AAG AGT GA | Wild type Forward | A | |||
| 49137 | ATG GGA GTC AGC ACC ACC T | Wild type Reverse | A | |||
| 49138 | GGC TCC TTC CTA CCT GTC TG | Mutant Forward | A | |||
| 49139 | CTC ACC TGT CGG TCT TAC TGG | Mutant Reverse | A | |||
| 49140 | Fluorophore-1 | TGA GGC TGG GGG ACG G | Quencher-1 | WT Probe | ||
| 49141 | Fluorophore-2 | CCT CTG GCA TGG TAG CTC ACT G | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49136 | 0.40 uM |
| 49137 | 0.40 uM |
| 49138 | 0.40 uM |
| 49139 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.