For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:43604489-43604588 100bp GGATGTGAGCAGGCTGTGTA ATGGTTTGCCTCCTGTGCT
Mutant= 100 bp
Wild Type = 100 bp
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
CAGGAGGCAGAGGCAGGAGGGAGGCTTGAGTCTGCCAAAATGCAGTGTTTGTTGCTAAGTCTCTCTGGTCTTCTATACCATATGAATTTTAAGCCAAGTATAGATTACTCTATACAATTAGAGGAAAGTACACTTTT^c^acatggtagaattcaaatgcaattaaagaatgtcatttctcttaaatgaattctagggctctcggatcggacactggtgggtccaccaggaaccctgctgcccactgtgggattgttggtttcaaaccaagctatggcttggtttcacggcacggccttattcccctggtgaattcaatggacgtgccaggaatcctcaccagatgtgtggacgacacagcaattgtgttaggtatttctgcagttgcaaagcctatttgaaagcctcactgtaaaacattctgtctgtcacagtaagggtttctccttgcaggtacactggctggacatgaccccaaagattccaccacagtgagaaaccctgctcagccggcctcggttcccggcgggatggatgtgagcaggctgtgtataggaatcccaaaggtaactcgcttctgttgctttacaaaaagctgggaagttagatgcagagcacaggaggcaaaccatgaccagcctggtgggtttgaatctcttagccactacctctacaggccttgtgactgctgtcggccaagccagcccagtgtctccccttgagaaatggggatagaatccagatcctgagagttgagaggattaaatttgattatcctataaagcaaggctctgtagactttccttggaaagaaagcaacaccacgtTAGGGTTTGTAGATCGTAGATCTGGCCATTATAGTGAAAAAAGCAGCCATAGGCAGTTTGTTTATTTACATAAAGAAATATGTCTGTATACCTATAAAATTTTCTTTTCAAAAAGTGGATACACGGTAATATGTTGCCTGTGATCAGTGTGCTGATCCTTACTGTAAAGGACATAGGCATTCCTTCTTTAGTAAGGCCCC
This is a 687 bp deletion beginning at Chromosome 10 position 43,884,488 bp and ending after 43,885,174 bp (GRCm38/mm10). There is a single bp (C) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49029 | CTA AGT CTC TCT GGT CTT CTA TAC CAT | Mutant Forward | A | |||
| 49030 | CGA TCT ACA AAC CCT AGA AAA GTG | Mutant Reverse | A | |||
| 49031 | Fluorophore-1 | TCC CAA AGG TAA CTC GCT TCT | Quencher-1 | WT Probe | ||
| 49032 | GGA TGT GAG CAG GCT GTG TA | Wild type Forward | A | |||
| 49033 | ATG GTT TGC CTC CTG TGC T | Wild type Reverse | A | |||
| 49034 | Fluorophore-2 | AGC CAA GTA TAG ATT ACT CTA TAC AAT TAG AGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49029 | 0.40 uM |
| 49030 | 0.40 uM |
| 49032 | 0.40 uM |
| 49033 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.