For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 76 bp
Wild Type = 94 bp
>chr5:121745930+121746023 94bp TGTTAGTGGTATTTGTGGCTTACA CCTAACAAAAAGCCCAGAGA
Sequence
Wt Sequence (with deletion in lowercase):
GCAGTCTTGTCTTTTCTTTCCTCTTTGTGGGATTCTCTCCTGGCCTGGTAGCACACAGCCACTGAGATTTCCTGTCACACTATATTagatggcgccttcacagtcagcttggcctgtgtttgagtagaattataagattatattttatgtactcattaatttaaataaaataaaaattgaatctaataaaacaatgtttaatctttgcagaggtcggaacagtagcaaaggactgcctcagcctacggtgagtaactttaatgttatttagaaaaatacataaactgtgatttccaatcatagactcaataataaagcaaagaattagatttccagttgtactacagatagtctatagataagtcagtttaatacaaggttgttgattcgggaaggcctctgaaatgaacacttttctgttagtggtatttgtggcttacataatactgatgtcaagggttttgatgttccaggaCCAGAGTTTGCAGAGTTCTCTGGGCTTTTTGTTAGGATTAATGTGCTGTCTGTTTTAACTCAGTCATTTTTCCTCCTTGGAAAACAC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49024 | TGT TAG TGG TAT TTG TGG CTT ACA | Wild type Forward | A | |||
| 49025 | CCT AAC AAA AAG CCC AGA GA | Common | A | |||
| 49026 | Fluorophore-1 | AAG GGT TTT GAT GTT CCA GGA | Quencher-1 | WT Probe | ||
| 49027 | GGT AGC ACA CAG CCA CTG AG | Mutant Forward | A | |||
| 49028 | Fluorophore-2 | TCA CAC TAT ATT CCA GAG TTT GCA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49024 | 0.40 uM |
| 49025 | 0.40 uM |
| 49027 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.