For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 86 bp
Wild Type = 80 bp
>chr18:78857841-78857920 80bp TGTCCCCTGTGAGTGAGTCC GGAGGTGCTGTTGTTGTCTG
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48580 | TGT CCC CTG TGA GTG AGT CC | Common | A | |||
| 48581 | GGA GGT GCT GTT GTT GTC TG | Wild type Reverse | A | |||
| 48585 | Fluorophore-1 | AGC GAC AGT GGC ATC GG | Quencher-1 | WT Probe | ||
| 48778 | CGG TTC TTT GTG CTG GTG TC | Mutant Reverse | A | |||
| 48779 | Fluorophore-2 | AGA CTA TCC CTT GAC AAC CCA GA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48580 | 0.40 uM |
| 48581 | 0.40 uM |
| 48778 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.