For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:23885671-23885777 107bp TGGCTGAGACTTTTACTGGAAAG TTTGCCAATCCTGTTGAAGA
Mut= 100 bp
Wt= 107 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGAAGAAGAAGAAGAAATATCTAGTAAGCACTTGGAATTGGCCCTGGAAAGAGGTAGAAGTAACTTTTTAATTATGATACAATTAAAGAAATAAAAGTGAAATCTTTCCATTTGTTCTTATAAAATGCTCCCATCAAGAATGACCTCACTCTGAAGAAGGCTAAAAAGCATGTAACAAAAACtaaagagaagacggggattggctgagacttttactggaaagagctgcagttcattaatttgatagttgagttccttaaaggggccttaaagtgcttttacacatctcttcaacaggattggcaaatgtacagtgtatcagttgtgcagtaaaagactggaaacttgtacatgttctttatgcaaagtaacttaaatgattgaatgccttttgctttattttagaatctcccaccttctgttgtggctactgttggtggtaaaattttcacatttggatcttacaggcttggagtacacaccaaaggtaattgctttttagttatgttctagtgataagaatttttaggaaactgttttacttgtttacaattagcgagtactgaacatagttcccatatcttactacTGTTAATAAACACTGTCTTATACTCATCTTTCATACCTAGTTCTGCATTTATGTTTATGTAAACTTTAATGAAAATATAATTTATCATTCTTAAGAAATAATTTTATTTTTTTAGGAGCTGATATTGATGCACTTTGTGTTGCCCCAAGACATGTAGAGAGATCAGATTTTTTTCAGTCCTTTTTTG
This mutation is a 407 bp deletion beginning at Chromosome 11 position 23,885,389 bp and ending after 23,885,795 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47356 | TCC CAT CAA GAA TGA CCT CAC | Mutant Forward | A | Mut F | ||
| 47358 | GCA GAA CTA GGT ATG AAA GAT GAG T | Mutant Reverse | A | Mut R | ||
| 48713 | TGG CTG AGA CTT TTA CTG GAA AG | Wild type Forward | A | Wt F | ||
| 48714 | TTT GCC AAT CCT GTT GAA GA | Wild type Reverse | A | Wt R | ||
| 48715 | Fluorophore-1 | TTG AGT TCC TTA AAG GGG CC | Quencher-1 | WT Probe | ||
| 48716 | Fluorophore-2 | CTG AAG AAG GCT AAA AAG CAT GTA AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47356 | 0.40 uM |
| 47358 | 0.40 uM |
| 48713 | 0.40 uM |
| 48714 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.