Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr10:17915993-17916143 151bp GGTGTTTGTTCTAGGGGAGGT CTCCCAAAGCTGCAGATCA
Mut = 131 bp
Wt = 151 bp
Fam = Mut
Hex = Wt
MUT sequence:
ggtgtttgttctaggggaggtgtaactcgcacgaatgggccaggcggacagatggacgcccTCttttgtcaccaagttaacttagagaattaaaggctgctttgtgggtacttggcgtgtgaggtatgagg
This mutation is a 8090 bp deletion beginning at Chromosome 10 position 17,907,992 bp and ending after 17,916,081 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48611 | GGT GTT TGT TCT AGG GGA GGT | Common | A | |||
| 48612 | CTC CCA AAG CTG CAG ATC A | Wild type Reverse | A | |||
| 48613 | CCT CAT ACC TCA CAC GCC AAG | Mutant Reverse | A | |||
| 48614 | Fluorophore-1 | CTG AAT CTC GTT TTC TTC CTC TTT C | Quencher-1 | WT Probe | ||
| 48615 | Fluorophore-2 | CCC TCT TTT GTC ACC AAG TTA ACT | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48611 | 0.40 uM |
| 48612 | 0.40 uM |
| 48613 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.