For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = -------
Wild type = GACAATT
Wild type = GACAATT
>chr8:85073486+85073572 87bp ATGGCTCCCATTTCCAGGAT GTCCAGAATGGGCATGAGC
Sequence
WT sequence with deletion in lowercase:
ggctttgagtagtggtcggggcggggaagctgggcagaggatccccgtgacccatgcccgcatggctcccatttccagGATTGGAAACCTGCTGGTGCCGAATgacaattACTGCAAGTTTGAGGACTGGCTCATGCCCATTCTGGACCAGATGGTGCTGGAGCAGAACACAGAGgtggggctggaagggctcggggacctgcatagtaagag
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48604 | ATG GCT CCC ATT TCC AGG AT | Forward | A | |||
| 48608 | GTC CAG AAT GGG CAT GAG C | Reverse | A | |||
| 48609 | Fluorophore-1 | TGC CGA ATG ACA ATT ACT GC | Quencher-1 | WT Probe | ||
| 48610 | Fluorophore-2 | TGG TGC CGA ATA CTG CAA GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48604 | 0.40 uM |
| 48608 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.