For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = T, C
Wild type = A, A
>chr8:85073486+85073557 72bp ATGGCTCCCATTTCCAGGAT GAGCCAGTCCTCAAACTTGC
Sequence
catgcccgcatggctcccatttccagGATTGGAAACCTGCTGGTGCCG(aa/tc)TGACAATTACTGCAAGTTTGAGGACTGGCTCATGCCCATTCTGGAC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48604 | ATG GCT CCC ATT TCC AGG AT | Forward | A | |||
| 48605 | GAG CCA GTC CTC AAA CTT GC | Reverse | A | |||
| 48606 | Fluorophore-1 | CTG GTG CCG AAT GAC AAT TA | Quencher-1 | WT Probe | ||
| 48607 | Fluorophore-2 | CTG GTG CCG TCT GAC AAT TA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48604 | 0.40 uM |
| 48605 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.