For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:76292776+76292870 95bp AGGAACAGGGAAGGGATGAT CTCTACTGTCCTGCCCCAAG
Mutant= 102 bp
Wild Type = 95 bp
Sequence
Partial Wt Sequence (deletions in lower case:
GCCCGGCTCACTCCTCCCAGCCAAAAGTAGAGAGCCAGGTTAGCTGTCTTTGAGTACGACCACTAGGAGccgctcttctggtgtggggttggcggcagagagggacagaccaacatccagaaccctctaaagtggcacagaatgctctctgtgctgaatgcctctggctactccacagatgccctcatccaacccacctaaggaatgatgctcagagagggcaggtcaagccagccagctcagcagacagataccttgaccagacatgagtgggtctttgtgttctttctgtatccacaggtgtattcctgcccccagcttcagcagcagcaaaggagccctgctcagaagacttggggatggtagcactggcacctctggctgacatgttgaataccccacagctcagtcctgcagcaggctcccttgtgaaccccctggctgctactcttaacccactgctgtctggccaaatacccttgttgcagaacaaccagtttgccaatcttgtgccatgctccatgagcaaccaactgaccaatcctactacagtttccccaggagtcaccttggccagttctctgggtttgccctctactggacccctgaacagtcaaatgactagtcccatgactgtacccccagggaccactctggccagctcactgggcctgacctcaactggttccctaacaacaagcagccggctggtggg.........................ttacttggtaatgaaaacagaagttctgggagcggaggaaaaaaaagagggagtaggatcaggaacagggaagggatgatgcagaaagaaaggatacttccctgttcttagCAAAGGGGTAGGGAGCCTCAGGGCCTTGGGGCAGGACAGTAGA.
This is a 9510 bp deletion beginning at Chromosome 15 position 76,283,317 bp and ending after 76,292,826 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46672 | Fluorophore-1 | CGA CCA CTA GGA GCA AAG GG | Quencher-1 | MUT Probe | ||
| 48499 | TCC TCC CAG CCA AAA GTA GA | Mutant Forward | A | |||
| 48500 | CTC TAC TGT CCT GCC CCA AG | Common | A | |||
| 48501 | AGG AAC AGG GAA GGG ATG AT | Wild type Forward | A | |||
| 48502 | Fluorophore-2 | AGA AAG GAT ACT TCC CTG TTC TTA GC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48499 | 0.40 uM |
| 48500 | 0.40 uM |
| 48501 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.