For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 103 bp
Wild Type = 87 bp
>chr12:54770717-54770803 87bp CACGGGAAAAACTGCAGAAG ACGCTTCCAGTTCCTGTTTC
Sequence
Wt Sequence (deletion in lowercase):
CTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTAGAAAAACAAACAAACAAATAAACAAAAAAAGAAATCGTTCGTTAAAGTtagttatttggttttgttatagatcccaccagcaccaccaagacctgattttgatgcttcacgggaaaaactgcagaagcttggagaaggggaagggtcgatgacaaaggaagaattcacaaagatgaaacaggaactggaagcgtatgtgatgtttttttaacaattacttttgttaattgtgctctctgatactgtagtgactgaaaaagccagggtaagtcataagagtcactatcagagcctcttcaggaaaagagcaccattgtcttcattgtcagatttaaaattatttaaatagactctgaaaattgaaaattgaggatctaaaaccttattgaagtactaggaaggcaatatgaccttaaaacggtatccatttataaggcctCAGTCATCCTCACCTGTCTCTGTTTTCTCAGCGTGTATCTGCCCTACAGCTTCCATTTCTTGTAGAAAGTGTGCTGAGCATCTCTTTACATTTTTTCTTTTATGGCCTGGTCTATAGAGTGAGTTCCAGGACAGCCAA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47972 | TAG GGC AGA TAC ACG CTG AG | Common | A | |||
| 48127 | CAC GGG AAA AAC TGC AGA AG | Wild type Forward | A | |||
| 48128 | ACG CTT CCA GTT CCT GTT TC | Wild type Reverse | A | |||
| 48129 | Fluorophore-1 | TTG GAG AAG GGG AAG GGT C | Quencher-1 | WT Probe | ||
| 48130 | CCC TGT CTA GAA AAA CAA ACA AAC | Mutant Forward | A | |||
| 48131 | Fluorophore-2 | CGT TCG TTA AAG TCA GTC ATC CTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47972 | 0.40 uM |
| 48127 | 0.40 uM |
| 48128 | 0.40 uM |
| 48130 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.