For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 87 bp
Wild Type = 95 bp
Mutation description: 1028 bp deletion
>chr3:8545128+8545222 95bp CTCTCAGCCTCCAGGTTTCT GAGGAAAGGGTGCATTTGG
Sequence
Wt Sequence: agctgggcaaagcacagaaaggaggccgggaagcaacgtgcctccatgggctctgcttcactctcagcctccaggtttctgctgaagtctgagccctggcttccctcagtggTGGATTGTGTCGTGGAAGTGTAAGCCAAATGCACCCTTTCCTCCCAAGTTGGTTTTTGTCATGGTGTTTTGTCACAGTGA
Mutant Sequence: cttcactctcagcctccaggtttctgctgaagtctgagccctggcttccctcagtgGTggagggcagaggttggaaagcccagtaaagagcacttcccaagttccattccaagcatccatttcaag
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48340 | CTC TCA GCC TCC AGG TTT CT | Common | A | |||
| 48341 | GAG GAA AGG GTG CAT TTG G | Wild type Reverse | A | |||
| 48342 | Fluorophore-1 | TGG ATT GTG TCG TGG AAG TGT A | Quencher-1 | WT Probe | ||
| 48343 | TGC TCT TTA CTG GGC TTT CC | Mutant Reverse | A | |||
| 48344 | Fluorophore-2 | CCT CAG TGG TGG AGG GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48340 | 0.40 uM |
| 48341 | 0.40 uM |
| 48343 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.