Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr19:41924549-41924709 161bp TAAGTTCTTGCTCCCAAGTCC ACATCTTTAGCACTGGGTGTTAC
Mut= 160 bp
Wt= 161 bp
Fam=Mut
Hex=Wt
MUT Sequence:
aaccccctcctctgacctctgtagacagcagacacacatgtggtacacacacatacatgtaggcaaaacactcatcgcatcagataactctaaaaataaaagcaaaaccaagcaaagacccatggtcccctacaattgtaacacccagtgctaaagatgt
This mutation is a 3625 bp deletion beginning at Chromosome 19 position 41,924,589 bp and ending after 41,928,213 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48293 | TAA GTT CTT GCT CCC AAG TCC | Wild type Forward | A | |||
| 48294 | ACA TCT TTA GCA CTG GGT GTT AC | Common | A | |||
| 48295 | AAC CCC CTC CTC TGA CCT CT | Mutant Forward | A | |||
| 48296 | Fluorophore-1 | ACC ATG GCT ATC TGG GAA GC | Quencher-1 | WT Probe | ||
| 48297 | Fluorophore-2 | ACC AAG CAA AGA CCC ATG GT | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48293 | 0.40 uM |
| 48294 | 0.40 uM |
| 48295 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.