Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr15:99033984+99034082 99bp TTGAAGTATAGTCCTAGGCAGGAG GGGAAGAACGTGTGAGAATG
Mut= 98 bp
Wt= 99 bp
Fam=Mut
Hex=Wt
Mut Sequence:
ttgaagtatagtcctaggcaggagtggccatgatatgacagccatcactgtccctaactgaatcatggattcatgactcattgagtgtgcccagttga
This mutation is a 4195 bp deletion beginning at Chromosome 15 position 99,034,012 bp and ending after 99,038,208 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48219 | TTG AAG TAT AGT CCT AGG CAG GAG | Common | A | |||
| 48220 | GGG AAG AAC GTG TGA GAA TG | Wild type Reverse | A | |||
| 48221 | TCA ACT GGG CAC ACT CAA TG | Mutant Reverse | A | |||
| 48222 | Fluorophore-1 | CCA TGC CCC AAG GTC TC | Quencher-1 | WT Probe | ||
| 48223 | Fluorophore-2 | ACA GCC ATC ACT GTC CCT AAC T | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48219 | 0.40 uM |
| 48220 | 0.40 uM |
| 48221 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.