For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:101095967+101096071 105bp AGCCTTGGAGGTGGGATTC TGCACCTCGCTTTGTACTTG
Mutant= 108 bp
Wild Type = 105 bp
Sequence
Wt Sequence (deletions in lower case):
GGACATTGATGGTGATTGTCTCATGGGAGCACAGTCTGTGGGAAGTTGTTAGGAAAAGCTTCCCGGAAGAGCCTTGGAGGTGGGATTCCCGTGTGACCTCaggtggcctgggcagctttggtgactagtttaccccatgctagaagtgtgagctcaagtacaaagcgaggtgcaggctcatgtgggtagtaagtgctctgtttgagtggaacatggggtatgtttaggggtgtgtgtgtgtgtgtgtgtgtgtgtgtgtacacggtgggggaggatagcagtcaagctcggtcatccactaaccactaaccacattgatatacttactgagttttcctggccttgtgtctttcaggaggttcatgagttattacaggactatgagctaaagtattgctatgtggacaggaataaacgaacaggtgagagctcccttccaagcccttgacctcttgaccccgctttcatttttgcatttattgtagagcaggaaagctcgcgctgtcttctccttctggtgctggggattgaactcacggccttcacaggtgctgacaagcatttcaacactgagctctggtctgggtccgcggTGGGGTTCCTAAGTGTTTACATCCCATCAGTGTGGCTCAAGGGTTACTTTCTGAATGTCCTGAACTTTAACCGAGTGTAGCTGGAGCTCTGTGATTCTTAACTATGAATGTTGAATGTTATGTGTTAACAAGTGTTCTCCAGT
This is a 493 bp deletion beginning at Chromosome 4 position 101,095,998 bp and ending after 101,096,490 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46728 | AGC CTT GGA GGT GGG ATT C | Common | A | |||
| 46729 | TGC ACC TCG CTT TGT ACT TG | Wild type Reverse | A | |||
| 46730 | CAC TCG GTT AAA GTT CAG GAC A | Mutant Reverse | A | |||
| 48132 | Fluorophore-1 | CTG GGC AGC TTT GGT G | Quencher-1 | WT Probe | ||
| 48133 | Fluorophore-2 | TGT GAC CTC TGG GGT TCC TAA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46728 | 0.40 uM |
| 46729 | 0.40 uM |
| 46730 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.