For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:37302784-37302897 114bp AAAGAGGAGGATTGAAAAGT AGCCCAAACATGGTGATTTC
Mut= 102 bp
Wt= 114 bp
Fam=Mut
Hex=Wt
Sequence
Mut Sequence:
tctgttagacttctttgcagtatctaaagacgtactgttcttaaagtttCGgtaatggaatgcttgctaacaccaaaggctagaaatcaccatgtttgggct
This mutation is a 13,775 bp deletion beginning at Chromosome 9 position 37,302,836 bp and ending after 37,316,610 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48073 | AAA GAG GAG GAT TGA AAA GT | Wild type Forward | A | Wt F | ||
| 48074 | AGC CCA AAC ATG GTG ATT TC | Common | A | Common | ||
| 48075 | TCT GTT AGA CTT CTT TGC AGT ATC T | Mutant Forward | A | Mut F | ||
| 48076 | Fluorophore-1 | CTC ATT CTG AGA CTG AAG TAA CCA GTT | Quencher-1 | WT Probe | ||
| 48077 | Fluorophore-2 | CTT AAA GTT TCG GTA ATG GAA TGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48073 | 0.40 uM |
| 48074 | 0.40 uM |
| 48075 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.