For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:31626957-31627068 112bp CCACTACTATCCATTTACAAACGT CCAGCCTTTTAAATAATGGACTTTAG
Mut= 113 bp
Wt= 112 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
AGGCTGGATTATATCTGTTGCTGACAGCAAGTTGGATTTTAGTCATGCATAGAAATGGAAAGAGTCAGAGATAATATTTCACAGTAGATCAAGACTTGACAGTAAGATGATAAGTGAGCCCCAGACGAATGATTTTAAAATGCTATAGTGCTGATTAATAACTTGCCACTACTATCCATTTACAAACGTCCATCTTTAAGCTCAATACCCTGTCAGGTACtaaagagggacagacagaaagaaaggcatatctaaagtccattatttaaaaggctggtaggttattctacaactccttcttgtttaaagaaaatgctttcttaaaaactaaaagtagcgtcctctgtcttgtaacagatgccgtgagagaagtaagaaagtattcgtccacgaatgttgtagagaagaactcagccatcagaccgagtgcctttgagcacacacagatgaagctcttcaggtctcaaagaaatctgtatatttctggattctcattatttttttggCTGtaagtaaaaaaaaatttgctagcagttgtatcactcatagaactcccctttgttttttccacttacACTAAGATCTTTTCATTGATATCTTCATAAAAGAATGCAAATGATACACTCAAGTAACAAATCTCAGTCACACTAAAGAACGCTTGGAATGGAAGATGTTGCCTTTGGAAGGGAAGAGCCCATGAATTGGTTGTCCAATGCCAAATGTTCAGCCCTGAAAACATACATCCAGGTAGCAGTATATGGACTGAACAGGCTATATTTAGGAATATATATGTATG
This mutation is a 355 bp deletion beginning at Chromosome 12 position 31,626,659 bp and ending after 31,627,013 bp (GRCm38/mm10).In addition, there is a 3 bp endogenous retention (CTG) 286 bp after the start of the deletion and then an additional 66 bp after the 3 bp retention.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46975 | CCA GCC TTT TAA ATA ATG GAC TTT AG | Wild type Reverse | A | |||
| 46976 | GTT ACT TGA GTG TAT CAT TTG CAT TC | Mutant Reverse | A | |||
| 46977 | Fluorophore-1 | AGG GAC AGA CAG AAA GAA AGG | Quencher-1 | WT Probe | ||
| 47858 | CCA CTA CTA TCC ATT TAC AAA CGT | Common | A | |||
| 47917 | Fluorophore-2 | AGG TAC CTG ACT AAG ATC TTT TCA TTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46975 | 0.40 uM |
| 46976 | 0.40 uM |
| 47858 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.