For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:23902255+23902354 100bp AGCTACAAGCTTTTTGGGTTAG CATGAACTCATACTCTAAAGGTCCT
Mut= 118 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (AGCAAG insertion):
GTGAGGCTAAAATTGGCAAAGGCAGAGCTGAATGCCAAATGATAATTTCTGCTAAATAATTCAGGCCATGTGAACTTTGATATTTCCCTTACTTTAATGAGTATAATGTGGGCAATTACCAACTACTCTTCTCACAGAGCCAGACAATGTGCTTTTTCCTAGTTATGGGCTTCATTTTTCTTCGGGTAACTCATATCTGCAAAGTTTGCTATAAATGCAGGGCCTTGCTCATGCGACC^gctgcataaatgtatattactgaggtgatggtaattataacgaggaagtttagcatgtctgtaagctgttcatcaatagacaaatcttatgacatgggacttgagttcttctgtgacactgtctttctccttttccccatgcagggaagcgatgctgacatggtggataagaataaatgctgtacactctgtaacatgtcctttacctcagctgtggtggccgactcacattaccaaggcaaaatccacgccaaaaggttaaaactgttgctaggagagaaacctccactgaaaaccacaggtatgtatggaaagaaaaaaaatgatccaggctggtacagagaacctctcttttcagccataggaatcaacctctttttcagaagctacaagctttttgggttagatggcaggtgccattcaaaacc^CACAGGGAAGGATGGGAAGGCTGAGCCGAACAGGACCTTTAGAGTATGAGTTCATGGGCTTGTGCACTGTCTTTCATCTAATGCTTACAGCCTCCAGGATGTCTGTCACGTTGATTGCATATCATGTGAGATACACATCTCTAGTGCTCTTTCCAAGTTCAGCCCACAGTCCACATTGGTATGGTTGTGCACACTGCATAGGTAGTAGGTTCTTGCCAGTGTCTATGGAAAGCAATTAGCATCCTTGACATTTGTGCTTTGA
This mutation is a 428 bp deletion beginning at Chromosome 8 position 23,901,871 bp and ending after 23,902,298 bp (GRCm38/mm10). In addition, there is a 6 bp insertion (AGCAAG) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47844 | AGC TAC AAG CTT TTT GGG TTA G | Wild type Forward | A | |||
| 47845 | CAT GAA CTC ATA CTC TAA AGG TCC T | Common | A | |||
| 47846 | CGG GTA ACT CAT ATC TGC AAA GT | Mutant Forward | A | |||
| 47847 | Fluorophore-1 | ATG GCA GGT GCC ATT CA | Quencher-1 | WT Probe | ||
| 47848 | Fluorophore-2 | ATG CGA CCC TTG CTC ACA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47844 | 0.40 uM |
| 47845 | 0.40 uM |
| 47846 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.