For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:161967981-161968089 109bp CATCTCTCTGGCCCTGTGAC ACTTTGGAACAAAAGCCTACA
Mut= 89 bp
Wt= 109 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTTTAACTTTTTTTTAATATTTTGTTTTTAATTATGTCTACATATGTGCTCCTGACTCCAGGTGTCTGTGGAGGTCAGAAGAAGGTGCTAGGTCCCCTGCCGCTATAGTTACAGGCAGTCATGAGCTGGCTTGTGGGTGCTGTCAACTAAACCTGGCTTTTCTCCAAGAGGAAGGAGTGCTGTTAGCCACCAAGGCATCTCTCTGGCCCTGTGACTCCctttaagatttagtcttcggaagtgtgataaactctgcaacctgatctctttccatttctctctctgtaggcttttgttccaaagtttgacaagattccttggctgagtgaggccagcctggtaaacaaaccattgatcctgagcatccccagaaggtaacttcccagcttctgaggacagagccttcgaggcagagctcagtggttgtactcttaaggtggagaggtgcatgtgccctgttgagaaaccaagtcgaatgcaaaaaaaagaaaaagaaaaagaaaaaagaaagaaacgccctgggtttctcagacaaaggttatgctatgtaaaggcctggctagaagaaatgagagccgccataacCTTCATTTCTGCGTGTACTATTCAACCACAGACACTGTAACTCAAAACACTTCCATAGTTTCCCCCCACCCCGCTTCAATTTCTAGTCTTCGAATTCTAATTATCAATAACCTAGAACTATAACACGCCATCTTTATAGAGTAGCAATAGCTGTATTTCACGTGGGGCCTCCTCCAGTTTCATGGGTCG
This mutation is a 367 bp deletion beginning at Chromosome 1 position 161,967,700 bp and ending after 161,968,066 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47768 | CAT CTC TCT GGC CCT GTG AC | Common | A | |||
| 47769 | ACT TTG GAA CAA AAG CCT ACA | Wild type Reverse | A | |||
| 47770 | GGG GGA AAC TAT GGA AGT GT | Mutant Reverse | A | |||
| 47771 | Fluorophore-1 | CTG CAA CCT GAT CTC TTT CCA T | Quencher-1 | WT Probe | ||
| 47772 | Fluorophore-2 | CTG CGT GTA CTA TTC AAC CAC AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47768 | 0.40 uM |
| 47769 | 0.40 uM |
| 47770 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.