Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr19:23378945-23379073 129bp GACCCAGTGTTCAGGCAATAC GAGGATCAAAGACAAGGAATTAGTC
Mut= 125 bp
Wt= 129 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (T insertion):
CTCAGCCTGTTGTCAAATGGGGAAGTGGTATGGTCAAACCGTGTAGAGGTGTCCAGCCTTTGACACTGTCGTATGATATCCTTTACAAATGTGTTGGGATGCATTAATATACTATAGGATGCATGAGGCCCACAGGGTATGGTTAGATGTGGCCCTTTCACAGGAGACCAGGGACCCAGTGTTCAGGCAATACCG^ttgggatgatgcaatgcaagctctgtcttcctacagatttatgggaccaaacagttgtcctttctccaggttgcatcagaagactaattccttgtctttgatcctctccctttcaggccattatgtctatatggacacctcttttgccaggcaaggggagaaagctgtgctgctgagttctgatttgcaggctgaggagtggaactgtttgcgcctggtctaccagataaccacacctccgggatctgtgtcagaccccagccagctgaacctctatgtgagatttgaggatgagagcttcgatcgcttgctttggtccactaaggagccttcagacagctggctcatagccagcctggatcttcaaaacagctccaagaaattcaaggtaggtggggtttaagaggaagatgtgagggtgtgtaacatgtgttctatgctatatg^AGGTCTTAGAGAAGTGGTTCCAACCTTCTGAATGCTACAACCCTTAAATACAGTTCCTCATGTTGTGGTGATTCTCCAACCATAAAACTTTTTTTTGCTGCTACTTTATAACTGTAACTTTGCTACTGTTATGAATTGTAACATAAGTTTCTGTGTTTTCTGAGGGTCTTAGACAACCCCAATGAAAGGGTCATCTA
This mutation is a 446 bp deletion beginning at Chromosome 19 position 23,378,605 bp and ending after 23,379,050 bp (GRCm38/mm10). In addition, there is a single bp (T) insertion at the deletion site.
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47645 | GAC CCA GTG TTC AGG CAA TAC | Common | A | |||
| 47646 | GAG GAT CAA AGA CAA GGA ATT AGT C | Wild type Reverse | A | |||
| 47647 | GCA GCA AAA AAA AGT TTT ATG G | Mutant Reverse | A | |||
| 47648 | Fluorophore-1 | ATG GGA CCA AAC AGT TGT CCT | Quencher-1 | WT Probe | ||
| 47649 | Fluorophore-2 | CGT AGG TCT TAG AGA AGT GGT TCC A | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47645 | 0.40 uM |
| 47646 | 0.40 uM |
| 47647 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.