For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:84459472+84459564 93bp CCAATGAGCCATCTCTCTACCT TGTATTTGTCACACAGCCTTCA
Mutant= 110 bp
Wild Type = 93 bp
Sequence
AGAATCAAACCTGGGTCCTCTGGAAGAACGGTCTGTTCCTCTTGCCCAATGAGCCATCTCTCTACCTACAAACCTGGATTTTTGAGATtgcagtttgccaggatttttaaacagtctgaaggctgtgtgacaaatacattcttataagaaggatgttcctgaatgaatatattctattttattttctgacagcccatcacaagctctccaccgaaatggatggctgagatagagcgtgatgacattgatatgttgaaaggtatgcgatgctggtgtctactctcctctttttcgacttggTTTGGGTTGGCTTGGGTTTTTGAGACAAGGTTTCTCTGTGTAGCCCTGGCTGTCATGGATCAGGCAGGCCTGGAACTTGGAGTTGTGCCTGCCTCTGTCTCCTGTGT
This is a 212 bp deletion beginning at Chromosome 12 position 84,459,515 bp and ending after 84,459,726 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47608 | CCA ATG AGC CAT CTC TCT ACC T | Common | A | |||
| 47609 | TGT ATT TGT CAC ACA GCC TTC A | Wild type Reverse | A | |||
| 47610 | CTG CCT GAT CCA TGA CAG C | Mutant Reverse | A | |||
| 47611 | Fluorophore-1 | TGC AGT TTG CCA GGA TTT TTA | Quencher-1 | WT Probe | ||
| 47612 | Fluorophore-2 | TTT GAG ATT TTG GGT TGG CTT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47608 | 0.40 uM |
| 47609 | 0.40 uM |
| 47610 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.