For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:81388589-81388683 95bp TGCCATCTCTCCAGCTTACC AAGCTAGTTTCACCTAAACCCTGA
Mutant= 111 bp
Wild Type = 95 bp
<p>TGS Design, DJL 6-6-19</p>
<p> </p>
<pre>
<tt>><a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgsid=729122631_udwo4AzzARLb9ZLIQ14NguIs7JSJ&db=mm10&position=chr15:81388589-81388683&hgPcrResult=pack">chr15:81388589-81388683</a> 95bp TGCCATCTCTCCAGCTTACC AAGCTAGTTTCACCTAAACCCTGA</tt></pre>
<p> </p>
<p> </p>
<p> Validator: DSW Date: 8/30/19 Req: 573002</p>
<p>Charge Assay Fee: Yes - Import</p>
<p>Mutant reverse has low GC content, not a great region.</p>
<p>Assay reveiwed, potentially hom lethal - need more samples to confirm. DSK 12/30/19</p>
<p> </p>
Sequence
Wt Sequence (deletions in lower case):
ATGTATGTGGTACTTTCAGAAGCCAGATCCCCTGGTACTGGAGTTGCCATCTCTCCAGCTTACCTAGTAATAGCTAGTAGTAGTTATTTctagcagggaagtagttaataatgtatcagggtttaggtgaaactagcttatagttctactagcaagtagttcattttgaggaagggatatacctttaaccttcatcctattggatagtacttagccctgagctccacacaaatcagttcatctcattttacagtttcaagccagtggctgttaactgtaccacactcgtaatttaggtttcaatctcatggttttcaccttttgcagAAATTGACAATGAAGGTGTAATTGAACCAGACACTGATGCCCCTCAGGAAATGGGAGATGAAAATGCAGAGgtaagtaagtgacattttaggaaaagtgaagttccccggggttggattattttataatataactcccaagatgtgtatgataaatcttcctttgactgatgacatactttataatttCACTAAAAGATTCAAAAATTCCCATGTTGTTTTTAACTATTATCTCTGACGTCTTGTATTTTGTTTTACTTGTTCTATCAATTTACTTCATTTTGACTAACCTGTAAAATTATTTCTCTAAAATAGATACCTACAATTAGAATTGTTCTTTTTTTTTTTTTTTTGAGATGATTTTGTCTTTTTTTCAAGAC
This is a 426 bp deletion beginning at Chromosome 15 position 81,388,213 bp and ending after 81,388,638 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47603 | TGC CAT CTC TCC AGC TTA CC | Common | A | |||
| 47604 | AAG CTA GTT TCA CCT AAA CCC TGA | Wild type Reverse | A | |||
| 47605 | AAA CAA AAT ACA AGA CGT CAG AGA | Mutant Reverse | A | |||
| 47606 | Fluorophore-1 | TAT TTC TAG CAG GGA AGT AGT TAA TAA TG | Quencher-1 | WT Probe | ||
| 47607 | Fluorophore-2 | AGC TAG TAG TAG TTA TTT CAC TAA AAG ATT CAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47603 | 0.40 uM |
| 47604 | 0.40 uM |
| 47605 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.