For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:140831117-140831207 91bp CCATTGTCCCAACCTAGAACC TGATCAGGGTCTGTCATCCTC
Mut= 87 bp
Wt= 91 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GCAGGACCTGAGCCAACCTTCTCTGGAGAGAATCCTGTCACCTGGGGCAAGTGGGGGAGGGGTGGGAGCCCCTGGACTTTGGCAAAAGTCCTGGCGCTCACTGGTTGTGGGACCAGACTGGTCATTCCCTCTCTACAGAGGATGAATAACGTCAAGGAAGGTCAAGCTGTCTAGGTCAGTAGGACAGACAGTAGCCCCAgtttgtctatctctctcgtatcctcagaaggtcctggagtcgccatacccaactttgtagccctattttctccttaaactgtgaggggctctggaacagtaccccaggtcacaattgccaaatagcttcaccttgccttctctcagggttgactctcttcccccaggtgaaggtgtcatactttgagtcacaggaggctgctgccctggcccacagtgtgctctacctaactgctgttggtgagtcccactccggcctgcctctggacacggtctggacatggatgtagtgacggtgactgaagctttcggggccttaggggggagcctcagctacccacctcacccctccgcttcttgggaacttcaaacatctccaggaccatagggattgagacccagccatgctcagagccaatagagcctagaaatgtcactgctatgagcacaatccacagtggcttcctcatgggagtcccattgtcccaacctagaaccatggagagtcataggcctctttcacccagagcccaCTGCAGCATCCTCTGAGGATGACAGACCCTGATCATAAGTCTCCAGGGGCTACATATAGTTAAGGGTACCCTGCATGTGACATAGAAACCCGGGGTCTCTAAGACATGGTCACTCAGTGCACATGGACAAGACAGGGACTTGTGTCCTTCCGACACCAGAATTGCCAATGTCGCTCTAGCCAGAGCCCCGAGGCCGACACACA
This mutation is a 532 bp deletion beginning at Chromosome 4 position 140,831,152 bp and ending after 140,831,683 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47580 | CCA TTG TCC CAA CCT AGA ACC | Wild type Forward | A | |||
| 47581 | TGA TCA GGG TCT GTC ATC CTC | Common | A | |||
| 47582 | AAC GTC AAG GAA GGT CAA GC | Mutant Forward | A | |||
| 47583 | Fluorophore-1 | AGT CAT AGG CCT CTT TCA CCC | Quencher-1 | WT Probe | ||
| 47584 | Fluorophore-2 | AGA CAG TAG CCC CAC TGC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47580 | 0.40 uM |
| 47581 | 0.40 uM |
| 47582 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.