For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:47527067-47527199 133bp TAACTTCTGGGAGCCCTAAGC AGAAACAAAGCACAGGTGTCAG
Mut= 122 bp
Wt= 133 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AAGCCAGAACAATTGTTCTTGCCACGTTGAGCATTCTGAGGTCTTTGGAAACTTCTTTCATGAGTGAATGCTTCCATTTTTATTTATGTTTTGGAACAGCCATGTAATATGGTTTGGGCATTATTTGTCCTGTCTATTGTGCTCAGGAGAAAATTCCACACTATTTTCTAGACAAATATGAACATATTAACTTCTGGGAGCCCTAAGCCCTCAGgaagaacaggagccctgctgccagggtgacagacttagaactttattcctgatgacaaacttgaataaatttgactacagagagctgacacctgtgctttgtttctgtttgtcaacaggggaagatgtcattgcttcggagcgggctgcggccttatgcaatgtgtgtgagctctcaggcaagtctctgtttgtgctgccccacactgaccaccttgtgggctacattataaggtaaatcagaggtttttttgttcttaagaaggaaggaaaagttggtaacttagatcctttatttacaaacaacaaagtgttcataaaaacattgtgcatggtgaagttcAGCTTGGCCAAGCACTAAATGAACAGACTGAAAGGAGTCTGAGACTAGCCTGGTCTACATTAGCAAGGTCCACTCTACCTGGGGCTACATAAGTAAGACCCTGAATCAAAAACAAACAGTGAGGATCTTCTAACACTGGCCTGATAGCCAAGCTATCTCTATAGCTACTTAGCCTGTTTTGCTTAAAAGCAGGGAAGAGTTTAATTCCAAAT
This mutation is a 342 bp deletion beginning at Chromosome 8 position 47,526,831 bp and ending after 47,527,172 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47503 | TAA CTT CTG GGA GCC CTA AGC | Common | A | |||
| 47504 | AGA AAC AAA GCA CAG GTG TCA G | Wild type Reverse | A | |||
| 47505 | TAC TTA TGT AGC CCC AGG TAG | Mutant Reverse | A | |||
| 47506 | Fluorophore-1 | CCT GAT GAC AAA CTT GAA TAA ATT TGA | Quencher-1 | WT Probe | ||
| 47507 | Fluorophore-2 | CCT GGT CTA CAT TAG CAA GGT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47503 | 0.40 uM |
| 47504 | 0.40 uM |
| 47505 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.