For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:45301038+45301195 158bp CCACCAGTGAAAATAAAATAGC GAGCACCAGAAAGGAAAATGA
Mut= 148 bp
Wt= 158 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGGTGGGGTGAGGGTGGTGTTCTCTCTGATTACAACCTGGAGAGGGATATTATTCAGAGAGAACTTTTGCCTTGCGTACTCAAGGCCCTGGGTCAGATCCCAAGCGATGCACACAGTTATAATAATTCTGTAATGTTCACGGTGAATACCCACCAGTGAAAATAAAATAGCAAACCATCAtagtggtaaaattaaaaataaacacaagccagttgcaggcttgttttaaagacaaaaaccttttcttctttaactttatatataaatgaaaaaaggtggcgggcattcattttcctttctggtgctcatgaagttctcaaacaattttgttttctggataatggaagaaaaacatgcaaagaaaacagagacactgggaaaggatagtctcctcaaagaagagcaaaaggaagcaggaaagagaacgaaggaaagccaagcgtgcagaagaccccggtaacggtgagcgtggttgccggtgaaaggtcatggctttcagcaaacttgtttttatgttgctgggagagtagggcctattactcagttcctctgcaagtcagcggaccagtgTCAACTTCGAGGTTGCTTTTAAAGTAGAAGCTAAGTGACCATGTGCAGCTGTAATCTCAGAAACGGGATGACGCCGGCGGTAGCGCATGCTCACTCATGCTCTGTGCTAGCTTAAAATCATGCATTGAGTACCTCAGGGCTGCTACGTACTGAGATTATCCGCTTTGTGTAGA
This mutation is a 390 bp deletion beginning at Chromosome 4 position 45,301,069 bp and ending after 45,301,458 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47481 | CCA CCA GTG AAA ATA AAA TAG C | Common | A | |||
| 47482 | GAG CAC CAG AAA GGA AAA TGA | Wild type Reverse | A | |||
| 47483 | TTT TAA GCT AGC ACA GAG CAT GA | Mutant Reverse | A | |||
| 47484 | Fluorophore-1 | ACA CAA GCC AGT TGC AGG C | Quencher-1 | WT Probe | ||
| 47485 | Fluorophore-2 | CTC AGA AAC GGG ATG ACG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47481 | 0.40 uM |
| 47482 | 0.40 uM |
| 47483 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.