For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:181590356-181590458 103bp GAGGGTTAGAGTGGGGTCCA AGGGTACATGCTCAAACAAACT
Mut= 112 bp
Wt= 103 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (CCAGCCCTCAC insertion):
GACCCACCAAAGCTAGGTGAGGAGCTAAGGCAGAAATCAGTTCTAGAGGATACAGATAGCCAGTGGTAGAGTTACCTCCTTGGGTATCCTGAGGACCTTTGTGGGGTGGAGATTGTCAGCCTTATTGTAGCCATGCTCTTGTCCTGGGTTAACTCCAGCCACTGGGCCTTTATCTGGGTGAGCCAAGACT^cagtctgggccaccgcccttgggggtcggtgatattgggcaaccactgagccttactgtctcctgtactatagggatgccagtggtccacagtggacatacagtgcctagccaggccccactctgctttgaccctggaaactcagccagtgacaagacagaagggaagaaaaaagggaggccgaaagccgagaaccaagctctccgagatattcctgtgagctccctgagggttagagtggggtccattcaatttagtctgtgaaggccacttccatgcccttaccagccctcca^TATATCCTGTGCCAGTTTGTTTGAGCATGTACCCTAGGGCCCTTGTGTCTGTTACAAAGTCCCAGTGGGCTGTGAGTAGTCATCAGCATAGGTCTGCAGCATGGCTTGAATTCCTGGTCTGCTCTTGAGGTTGAAGGGCTTATTTGGCTTGGGGGAACTTTAAGTCTGGGTAGCTACAGGTCAGCAGCTTGGCCTTTTCCTC
This mutation is a 295 bp deletion beginning at Chromosome 2 position 181,590,391 bp and ending after 181,590,685 bp (GRCm38/mm10). In addition, there is an 11 bp insertion (CCAGCCCTCAC) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47476 | GAG GGT TAG AGT GGG GTC CA | Wild type Forward | A | |||
| 47477 | AGG GTA CAT GCT CAA ACA AAC T | Common | A | |||
| 47478 | TTG TAG CCA TGC TCT TGT CC | Mutant Forward | A | |||
| 47479 | Fluorophore-1 | TGT GAA GGC CAC TTC CAT G | Quencher-1 | WT Probe | ||
| 47480 | Fluorophore-2 | CCA AGA CTG TGA GGG CTG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47476 | 0.40 uM |
| 47477 | 0.40 uM |
| 47478 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.