For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:57370892+57371019 128bp CAACAGACAAGAGGAGACAGAGG GTGGCTATCTCTGTTAGAAACTGTG
Mutant= 124 bp
Wild Type = 128 bp
This is a 499 bp deletion beginning at Chromosome 19 position 57,370,946 bp and ending after 57,371,444 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47445 | CAA CAG ACA AGA GGA GAC AGA GG | Common | A | |||
| 47446 | GTG GCT ATC TCT GTT AGA AAC TGT G | Wild type Reverse | A | |||
| 47447 | TGG CTA AGT AGG AGT GTG GTC A | Mutant Reverse | A | |||
| 47448 | Fluorophore-1 | CTG ACG GGC TAT GTT CCA G | Quencher-1 | WT Probe | ||
| 47451 | Fluorophore-2 | CAG TTT CTA GCT ATG GCA TAC AGA GAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47445 | 0.40 uM |
| 47446 | 0.40 uM |
| 47447 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.