For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:8683447-8683604 158bp ATTTTTTAGCCAGAAGTGCTGA CCCCTACCCTCCCAAAAA
Mut= 124 bp
Wt= 158 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case, insertion in ^g^ (ACCTG Insertion):
GATTTTTATCTCCATTTGAATTTCTGTATTACTTATCCTGGCTGCAGTTTTTTATCCATTCATTTATTTATTTATTTTAGTGTGGTGTGAAAACAAGCTATATAATTATTAAGGCTATAAGAAATGAGACTCAGTTTAGTAGTAGGTTTAAAGTTAGTT^ttctaattcttaggttctttaaaatattaagttgtcttttctacttttatttgctagtcggcagcaggaaatagaagaaaaactcattgaggaagaaacagcacgaagagtggaagaattggtagcaaaaagggtagaagaagaattggagaaaaggaaggatgaaattgagcgagaagttctccgaagggttgaagaagccaaacgcatcatggaaaagcagttgctcgaagaactcgagcgacagagacaagctgagcttgcagcacaaaaagccagagaggtaacgctcggtcgtttggaaagtagagacagtccatggcaaaactttcagtgtcaggtgtgcctcctgctcagtccagaacgagatggaatgcgactatcttaattcctttctcatctaaacttacatggctgcgaaagataattttttagccagaagtgctgactggtacttaaaagttactttcttaaaacttattcaaggatatttttgatccgatggaactggcttacatatttgagaagtgtttgaaacttttgc^CATGGCTGCAGGACTACATTCTTTTTTGGGAGGGTAGGGGGAACCAGGGAGTGGTAAAGGGAAAAGGCTAAAGATCCACCCGCGGTTGCATTTTCTTCTCTGTTATCACTCTGCTACCTAGACTGTGAGAGGCTTTGCCTTCAGTCAGATTACAGAGAGCAGGGT
The mutation is a 544 bp deletion beginning at Chromosome 8 position 8,683,487 bp and ending after 8,684,030 bp (GRCm38/mm10). In addition, there is a 5 bp insertion (ACCTG) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45186 | Fluorophore-1 | CTG GCT TAC ATA TTT GAG AAG TGT | Quencher-1 | WT Probe | ||
| 45187 | Fluorophore-2 | AGG TTT AAA GTT AGT TAC CTG CAT GGC | Quencher-2 | MUT Probe | ||
| 47420 | ATT TTT TAG CCA GAA GTG CTG A | Wild type Forward | A | |||
| 47423 | CCC CTA CCC TCC CAA AAA | Common | A | |||
| 47424 | TGT GGT GTG AAA ACA AGC TAT | Mutant Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47420 | 0.40 uM |
| 47423 | 0.40 uM |
| 47424 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.