Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr8:87780057-87780161 105bp CTTGGGGACCAGTGGGTATC CCTAACTCACACGGGCAGT
Mut= 120 bp
Wt= 105 bp
Fam=Mut
Hex=Wt
Mut Sequence:
cctgggaattgcctctaatctctcctctgccttcccctgcagATGGTGATGACGACCCACAGCTCTCCTGGgtaggtcttatcgcaacccagagaggcagcactgcccgtgtgagttagg
This mutation is a 3279 bp deletion beginning at Chromosome 8 position 87,780,106 bp and ending after 87,783,384 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45658 | CTT GGG GAC CAG TGG GTA TC | Wild type Forward | A | |||
| 45659 | CCT AAC TCA CAC GGG CAG T | Common | A | |||
| 45661 | Fluorophore-1 | AAC TCT TGC ATG TGT GCT TCC | Quencher-1 | WT Probe | ||
| 47218 | CCT GGG AAT TGC CTC TAA TCT | Mutant Forward | A | |||
| 47219 | Fluorophore-2 | CAC AGC TCT CCT GGG TAG GTC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45658 | 0.40 uM |
| 45659 | 0.40 uM |
| 47218 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.