For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:36788638+36788734 97bp CCGATCGAATTGGGGACT AGTTCAACAAACACACATCACC
Mut= 93 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case and insertion with carrots ^g^ (CTAC insertion):
AAGGTAAGAAAGAAAACATGCTGTAAATAGATCTTATCTGGGTTTCTGCCCTGCCCTCAAATCCCTGTCATTAGGGAAAGAGTAAGGAAACCATGGCTAGAAGTGGCTATGCATGAGAAGGAAAAAGGCTAAGGAGACATTTTAGAACAAGGTCCGAGTTACACCATGCAGTGGGGACTGTGGCTGGATTTCCTGAGTTGCCTC^gggctttactgaattcactgttagtcccttaagacatccataccaaaggaaaatgagaggtcctgcttcagttagagaaagggcggagctaatgtttggatcttaatgcagatgtcttgggaaggcgtgaggcatgagatggtggcaaagaaaggtctagctcccgaggtggccgatcgaattggggacttcgtccaatatcatggtaagaaccagggtttttag^AGCCATGATAGAACAGGTTGAGGGTGATGTGTGTTTGTTGAACTTCTACCTCTAGATCAGTTCCAGAGTTTAGCCTGGATAAAGGTTCCCTTTTATGTATTCTAACTGCTTTATATCTTCTTAGTAAAGGCAGAAACAGAAGAAGGTCTAGCCATGAGACCAAGGCTGCAGTCCTTTTAAAGAAAATGAGGAAGACTGGCTGGAGCATAT
This mutation is a 225 bp deletion beginning at Chromosome 18 position 36,788,466 bp and ending after 36,788,690 bp (GRCm38/mm10). In addition, there is a 4 bp insertion at the deletion site (CTAC).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47158 | CCG ATC GAA TTG GGG ACT | Wild type Forward | A | |||
| 47159 | AGT TCA ACA AAC ACA CAT CAC C | Common | A | |||
| 47160 | TAC ACC ATG CAG TGG GGA CT | Mutant Forward | A | |||
| 47161 | Fluorophore-1 | CAA TAT CAT GGT AAG AAC CAG GGT | Quencher-1 | WT Probe | ||
| 47162 | Fluorophore-2 | CCT GAG TTG CCT CCT ACA GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47158 | 0.40 uM |
| 47159 | 0.40 uM |
| 47160 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.