For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:4219956+4220072 117bp TGATAGACACAAATGCCAGGA GTGAGGGAGAGAGACCAGATG
Mut= 115 bp
Wt= 117 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTCATGGGACTGGAAGGCTTGGAGAAGAGACTGGGACACAACTGAAGCTTAGGCATATTGACACAAAATCCCTAAAGCCTGGCCTGCCCCTTTGAATAGACACATGCACACATATTTGGCAGATACATGCCAAAGACTTTCAGCTAATAGCAGTCAAGTATCTACTGATAGACACAAATGCCAGGATTTGTCTTTGCATACATACCTCcacatacgctcttggaccagaagtctttcccctcctccaccccctccatttcccatctggtctctctccctcaccccccttcctagcccaaggtggggacagacacctgaggggctgccagctgtttccctatttgggcctgggcccaccctcatacttcttgcccatcctattcacaggggactcgtgggggatgttagcttgcctatgcacggtgctgtggcacctccctgcagtgccagctcttaatcgcacaggagatccaggccctggcccctccatccagaaaacctatgacctcacccgctacctggagcatcaactccgcagcttagctgggacctacgtgagtatcccctttggcaaagaggaggcagaggctttggggaagagagagcatggggcaggggtcctagtgaatgATGGGGTGATGAGAGGCCCTTTGGGTCCACATAGCTTCTCCATCTGGCCTATCTTCTGCCCTTCCCTCTCAGGTGCCCCCCCCCAATCCTGGCCCCAGGAGTAGGCATGTGGGCAGGCCTCGAACCCGCCTTGGCCCATTGCCCCATTGGCTGCCAGCCCAGCTGCCTGCCTC
This mutation is a 422 bp deletion beginning at Chromosome 19 position 4,219,999 bp and ending after 4,220,420 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47153 | TGA TAG ACA CAA ATG CCA GGA | Common | A | |||
| 47154 | GTG AGG GAG AGA GAC CAG ATG | Wild type Reverse | A | |||
| 47155 | CTG AGA GGG AAG GGC AGA AG | Mutant Reverse | A | |||
| 47156 | Fluorophore-1 | ACG CTC TTG GAC CAG AAG TCT | Quencher-1 | WT Probe | ||
| 47157 | Fluorophore-2 | CAT ACC TCA TGG GGT GAT GAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47153 | 0.40 uM |
| 47154 | 0.40 uM |
| 47155 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.