For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:135371680-135371805 126bp TGTTAGCTCACCTGCCATGC CTGCCCCTGTCATTGTCAC
Mut= 129 bp
Wt= 126 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TCAATACCAGTCCTGCCCTTCTACCTACCTTGCCTATAACAGGGTCTCTTTGTTATTTTCCCCACTGTACCCCAGCATACGCCAGGCTAGGGGGCCTGCAGGCTTCTGGGGGTCCTCCTGTCACTGCCCACCGTGCCCACAGGAGCCCTGGGATTCCTATGCTGACTCATGAGGTTCCTGgggactcatagatgtctgataagagcttctcccactttccgttccctcttctctgcaggctctggagccatcgtggctgccattgtggtggttgtcatcatcattgtcaccttggtgctgatcctgctgaagatgtacaacaggtaccggaggcccagaactcgccagttctccacccccacacacagacctcccacccattccacctgtagactgttagctcacctgccatgcaagaccctgccctctgaaactctttgtcagagctgaggttcaaacccaaaccatgCGGTTTCAAAGAAAATATTCCCACCATAGCATGTGACAATGACAGGGGCAGGGGATGAAGTTTGGAAGGTGGAGCTCTTGCCTAGCATCCGTGAAGGCCTGGGTTTGAGTCCCAGTACCTTATAAATCAAGTATGGTGGCACTCAGGAGATAAAGGCAGGAGGACCAGAAGTGTACAGGATGAAT
This mutation is a 289 bp deletion beginning at Chromosome 4 position 135,371,731 bp and ending after 135,372,019 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47041 | TGT TAG CTC ACC TGC CAT GC | Wild type Forward | A | |||
| 47042 | CTG CCC CTG TCA TTG TCA C | Common | A | |||
| 47043 | CTT CTG GGG GTC CTC CTG T | Mutant Forward | A | |||
| 47044 | Fluorophore-1 | AGA CCC TGC CCT CTG AAA CT | Quencher-1 | WT Probe | ||
| 47045 | Fluorophore-2 | ATG AGG TTC CTG CGG TTT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47041 | 0.40 uM |
| 47042 | 0.40 uM |
| 47043 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.