For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:15980937-15981036 100bp GCAGTAATGTTTGTCTTACCAGT TGTGTATCTTTAAGGGTCAGAATCC
Mut= 85 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (A insertion):
TACTTTTTTCTATTAAGGGACTGAGTAAATCAACCTCTTTGGTGCACTTGTCTCTTGCAAATTGTCCAATTGGAGATGGAGGTTTAGAAAGTGAGTCAAGTCATTTAACACTTGTCCTGGGAGGGTGGTCTCATGTTTGTCTGTGTGCTGATAACTCTGTCTTTGGGGGCTGCTGCTTCCACCTGAGCTGCCTCCTTCCTGTGCCTGCTCAGATGCTAACCCATCTGTTAGTGGCTGGAGGGTGGTGGAAAGTGACTTTAGGGATACACCTTAAACTGGCATAGCTTGAAGACT^gcgaggaaaccgagactgaccacattggcaggcacgtggtcttactgtgtgtctttttctttcagttatttgtcaaggtataaagaactctgtcactctcaagaccgtcaactttacagggtgtaatctgacatggcaaggagcctgtcatatggccaagatcttaaaggtgacctttgaatgacaaatgtgattaaagcacattaatactttggtgtggggttgcagtaatgtttgtcttaccagtgcatagactgcaattttagtttcattgcatgctataaccattgtctagct^TGGGATTCTGACCCTTAAAGATACACATTTAATCTTAAAAATAAAGACTTTAAAGTATCATACTTCATGAATACTTGTTATTTTAGTTGTTGAAAACATTGCAGCACCAGAAGAAACTACTATTACAGTCTCCAATTATTTATAAACTAATAAAAACAGTTCATACAGTTTT
This mutation is a 297 bp deletion beginning at Chromosome 19 position 15,980,964 bp and ending after 15,981,260 bp (GRCm38/mm10). In addition, there is a single (A) bp insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46969 | GCA GTA ATG TTT GTC TTA CCA GT | Wild type Forward | A | |||
| 46970 | TGT GTA TCT TTA AGG GTC AGA ATC C | Common | A | |||
| 46971 | GAG GGT GGT GGA AAG TGA CT | Mutant Forward | A | |||
| 46972 | Fluorophore-1 | TGC ATG CTA TAA CCA TTG TCT AGC | Quencher-1 | WT Probe | ||
| 46973 | Fluorophore-2 | AGG GAT ACA CCT TAA ACT GGC AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46969 | 0.40 uM |
| 46970 | 0.40 uM |
| 46971 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.