For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:87224761-87224920 160bp TCAATCCAAACTCAACAAGCA CAGGTCAAGCTGCCTCCTC
Mut= 160 bp
Wt= 160 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTCCAAAATCAAAGCAACAGCAATCACATAAGAAGCCCAGTCTCTGCCTCAGTGGTACCAGCTGCTTTCGCAAAGGGGTTATTGGGGAGTGGGGGTGGGGCTTAAGCTCACAGAGGCTTCCAGGAACCAGCGGCTGGTTTCTGTGGCCACGtgacttaagctgcttcctgaaacacccttaccgccatcctctccccacagctgatgtgcaggtcaaacttctctgcattattgtgttctttctccctcccaggtgagttacggaaactaggggtccggtgcgtctatgacaacgctgctgtggcgagctgggccaaagtgttgttcctctgctgtctgcctgcccagctgcctaatatctgcctagaaattcaatccaaactcaacaagcactgcaccgtgtacagctttgtatccgccattccgctacccaggtatcttgtcaggatgagagcggaactcatagcctcttggcctacctcttggagTTAGGCATGCTCAGTAATGAGGAGGAGGAGGCAGCTTGACCTGCAGAAAGACCCCGCCAGCCTTTCTAGTTCTGTCTTCCTCCAGTTTTACACAAACAGCACTTGGGGTTTGGATGACTTTCCCTGCCTAAAATATTAATGGCCTGCTGCTTTCCAGTACTCCATTCCCACTTGGGGCAT
This mutation is a 337 bp deletion beginning at Chromosome 12 position 87,224,804 bp and ending after 87,225,140 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46894 | TCA ATC CAA ACT CAA CAA GCA | Wild type Forward | A | |||
| 46895 | CAG GTC AAG CTG CCT CCT C | Common | A | |||
| 46896 | CCA GTC TCT GCC TCA GTG G | Mutant Forward | A | |||
| 46897 | Fluorophore-1 | CAG GAT GAG AGC GGA ACT CAT A | Quencher-1 | WT Probe | ||
| 46898 | Fluorophore-2 | CTG TGG CCA CGT TAG GCA T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46894 | 0.40 uM |
| 46895 | 0.40 uM |
| 46896 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.