For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:13182741-13182863 123bp TACGTATGTGTGGGGCTTGC TTGTGCACTGAAACAGATGTC
Mut= 121 bp
Wt= 123 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AAGCATAGATTCATAACAGAAGTATTTTTACTAGGAAACGTTGAAGAAGGATGTTTTGTTTTGGTTTTTTTATTCTATCTTCCTAAACTGGACTTAAGTGTTTCAATCCTTCTGTTCTCTGCATACTTACTTAGATGTGATTGTATACAGTAAACGGAGTGGCTTTCTTGCCCCCCAGAGGGATACAGAACTCAGGACTTCTGTTTTGTTTTCTTTATAGCAGtggagcccaggcaggtgtccaactaacatcaaagctgaggttgaccttgaactcctgggcgctggaattaaagatacgtgttttactcagtttctcttttccttgtaggacctcgactggattttgatccagacatcgttgcagctcttgatgatgattttgactttgatgacccagaaaacctccttgaagatgactttattcttcaggccaacaagccgacaggaggagagaggatggatacgtatgtgtggggcttgccatactggtgtgtgtgtgggggggggggggtgggggtaaccatgttctagtagGAAGACAAGTTTGAGAGCACGTAGTCTAAGACATCTGTTTCAGTGCACAAATAGTTAGATTTGAACATATATTTCTGTAGTATCTGAGATCCCAGAACCTGGTGGCTGATGGCTTTTCCCACCACGCCAGGCTAGTGTAGCGCCATCTTGAGTCCCGTTCCCTCTGGAGCCTCCAGCAGTTGCTCCAGAT
This mutation is a 314 bp deletion beginning at Chromosome 10 position 13,182,791 bp and ending after 13,183,104 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46877 | TAC GTA TGT GTG GGG CTT GC | Wild type Forward | A | |||
| 46878 | TTG TGC ACT GAA ACA GAT GTC | Common | A | |||
| 46879 | AAC GGA GTG GCT TTC TTG C | Mutant Forward | A | |||
| 46880 | Fluorophore-1 | TGG GGG TAA CCA TGT TCT AGT AG | Quencher-1 | WT Probe | ||
| 46881 | Fluorophore-2 | TGT TTT CTT TAT AGC AGG AAG ACA AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46877 | 0.40 uM |
| 46878 | 0.40 uM |
| 46879 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.