For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:31648582-31648685 104bp GGGGAACGTGTATGTCAAGGT CAATGCCAGCAGCTTCAAC
Mut= 97 bp
Wt= 104 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (A insertion):
TCCAGGAGTCACCTTTTTCCTTGAACTTTGTATGGCCCTTTTGGTACCAACTAAAGCTGGCTATGGTTTTGGTAGCCAGGACTGAGGCTGTGGGCATTTAAGATCTCAGCAACTCCAAGGCACAAGCAAGTCGGTGCTCCTGTAGCATGCAGCTCTGGCCTGGCGTCCTCTAGACAGTCACTATAGCTGAGCT^cgagggcagcgaggccacagggctcaccatctgggtgtctttgactgcaggtgctgtgagcgacgtggagatgcaggagcactatgatgagttctttgaggtaagtgccgggtgcaaggtcggggtggccctgagagacgggctgtgtatggtgctcctcaatgcctgttctccttcaggaagtcttcactgagatggaagagaagtacggggaagtcgaggagatgaacgtctgcgacaacctaggggaccacctggtggggaacgtgtatgtcaaggtacagactggcgggcgctgtgggtgccgtcctggtgcctggctt^TAGTGAGGAGTGGGCTCTAAAGTTGAAGCTGCTGGCATTGGCACATGTTGTTAGCCTGTATACTTTGTTTCCTTTTCTGAAGTAAGGCTGTGTGGCAACAAGCTGGTGTTTGCTCTTAGTGGATTAGACTTGAAAAGGAAGGAAACACCTGGCTGCCGTGGGTCTATCCTGGGGAGGATTG
This mutation is a 323 bp deletion beginning at Chromosome 17 position 31,648,622 bp and ending after 31,648,944 bp (GRCm38/mm10). In addition, there is a single base pair, A, insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46818 | GGG GAA CGT GTA TGT CAA GGT | Wild type Forward | A | |||
| 46819 | CAA TGC CAG CAG CTT CAA C | Common | A | |||
| 46820 | CTC CTG TAG CAT GCA GCT CT | Mutant Forward | A | |||
| 46821 | Fluorophore-1 | ACA GAC TGG CGG GCG | Quencher-1 | WT Probe | ||
| 46822 | Fluorophore-2 | CTG GCG TCC TCT AGA CAG TCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46818 | 0.40 uM |
| 46819 | 0.40 uM |
| 46820 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.