For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:47827130-47827240 111bp TCTCTCCAGCCCACAAGTCA CGAAAGACCATCTCATTGTTCA
Mut= 118 bp
Wt= 111 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case, and insertion with carrots ^g^ (A insertion):
GTCTGTATATCACATCTGTGCAATGCCTCTGGAGAGCAGACAAGGGGGCACTAGGTTCTCTAGGACTAGAGTCAGTGATGGCTGTGAGCTACCATCCGAGAGTTGGGCATGCTGAGCCATCTCTCCAGCCCACAAGTCACTTTTGCAGAAGAGTCTGCTGAGTTAAAAACAG^ctgtccactctgtgagtctcaaattacttatgagagtgaacaatgagatggtctttcgtagccgtcatgacggtatctgtatgatgtctttcacttcagttcccactgacttttgaagatgtagccatttacttctctgagcaagagtggcaacacttagaggcctggcagaaggaactttacaagcaagtcatgagaaccaattacgagactctcatctctctaggtaaggagctttcaacttctctggtgattcttgcaactggatcttctcagagccccttggtcacttgatacacctgttaggtagcaagattgcttagatataacccagaaaggctttttcatctctttattgttgttgttaatactaatgtatacatcaccggtttgtccttagaggt^GGACCTTACAGGGAAGTATTTAAGACAGCATGTAGTATCATAGTCAGAGGTAGCAAGGATGAATGTTAAAACTTTCCCCATCACACTTTACTCTGAGATTGCCTGATTTTTCCACTGAGAAGCACACCTGCCTGTGCCCATAAAGTACCTGTATGCCTTAACCTAGAAAGTGGCTTCTCTGCA
This mutation is a 404 bp deletion beginning at Chromosome 6 position 47,826,784 bp and ending after 47,827,187 bp (GRCm38/mm10). In addition, there is a single bp (A) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46812 | TCT CTC CAG CCC ACA AGT CA | Common | A | |||
| 46813 | CGA AAG ACC ATC TCA TTG TTC A | Wild type Reverse | A | |||
| 46814 | CAT TCA TCC TTG CTA CCT CTG | Mutant Reverse | A | |||
| 46815 | Fluorophore-1 | CTG TCC ACT CTG TGA GTC TCA AAT | Quencher-1 | WT Probe | ||
| 46817 | Fluorophore-2 | AAA CAG AGG ACC TTA CAG GGA AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46812 | 0.40 uM |
| 46813 | 0.40 uM |
| 46814 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.