For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:125666304-125666423 120bp TGTCTAAGGCTTTGGCTCAGT GGCAACATAGTCTGTGGTATCCTAT
Mutant= 105 bp
Wild Type = 120 bp
Sequence
Wt Sequence (deletions in lower case):
CAACATTAACGGGCTGAGAACTTATGCCATAGAAAAACAGTTATGTCTAAGGCTTTGGCTCAGTTGGGTCctaaggaagtcttatcttattcattcattttaaatgcaattgtttctctctctccctctctttcttttataggataccacagactatgttgcctatgtagctaaagatccagtcaaccaacgaggtatggacaagaaacttctgggttttcataagagctgttagctaccgactataaaaataagtggttatttctaatgtacacagtaatgggtgtcacacagtaaggccctatctatgggcattgctttctgttatcttaggagtcatggtcattgcagacttgagcactcttgctaagctgaacaggcgataaagagaagctgtgaggcccctcctggcctgtttcatagtcttccaaacgatgggcatggtccaatggtgccccatcattgtaggatgatattgaaggactctaagaaaactatgtaaattttaattgaaaataaataatcctaccagcagagaagagtggaacaattaacaggcaatatttaaattccagcacttgaaagattcACAAACTAAAAAGCATATTTACATATGCAAAAATAAGCTGTTTTGTTTATGGTAGTGTTGTTCCCATATCCCAAGGAGAAAAAGAAATTGAACACAAAACTCAATGAGACATTGCTGTTGGTGTGTGTGTGTGTGTG
This is a 519 bp deletion beginning at Chromosome 2 position 125,665,878 bp and ending after 125,666,396 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44276 | CTC CTT GGG ATA TGG GAA CA | Mutant Reverse | A | |||
| 46744 | Fluorophore-1 | TGG GTC ACA AAC TAA AAA GCA TAT T | Quencher-1 | MUT Probe | ||
| 46745 | Fluorophore-2 | TCT TAT TCA TTC ATT TTA AAT GCA ATT G | Quencher-2 | WT Probe | ||
| 46746 | TGT CTA AGG CTT TGG CTC AGT | Common | A | |||
| 46747 | GGC AAC ATA GTC TGT GGT ATC CTA T | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44276 | 0.40 uM |
| 46746 | 0.40 uM |
| 46747 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.