For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:5886560-5886662 103bp GGCCAAGCAAGTGCATTTTA GATCCCAAACAGCGGAATC
Mutant= 100 bp
Wild Type = 103 bp
Sequence
Wt Sequence (deletions in lower case):
TTAGAAATCATAAGCAGTCAGTCTCCAACAGGCATTGTAGGCCAAGCAAGTGCATTTTATTTAAGAGGGAGACTGCATGCAGAGCGCCCTTGTgttccactaagtgttttatgtgatgtttcagattccgctgtttgggatcatgtcatcggactctgcagatcccttctactggatgagagttattcttgcatccaacagaggtatgcacttctgacctccatcctgccaccaacctccatcctgccaccaacctccatcctgccaccaacctccatcctgccaccaaacagctgctttgtggttttaTATAGGAGAGACAAAACAAACCCATTGCTTAGGAGGAGAATCCAGCTTGTAATAATAACAACACTGGCGTGTGTGTGTGTGTGTG
This is a 216 bp deletion beginning at Chromosome 2 position 5,886,393 bp and ending after 5,886,608 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46738 | GGC CAA GCA AGT GCA TTT TA | Common | A | |||
| 46739 | GAT CCC AAA CAG CGG AAT C | Wild type Reverse | A | |||
| 46740 | GCT GGA TTC TCC TCC TAA GCA | Mutant Reverse | A | |||
| 46741 | Fluorophore-1 | AGC GCC CTT GTT ATA GGA GAG | Quencher-1 | MUT Probe | ||
| 46742 | Fluorophore-2 | CCA CTA AGT GTT TTA TGT GAT GTT TC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46738 | 0.40 uM |
| 46739 | 0.40 uM |
| 46740 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.