For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:65717527-65717620 94bp TGAGGCTCCTAAGTCTGTGG ATTTCCACAAGGCACGGTTT
Mutant= 74 bp
Wild Type = 94 bp
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
CTCTCTCTCATTACTTCTTGTTTAGGGACAAGGGTTCTTAGGGTCATTTTGAGGCATAATAACAGGAACTGAGGCTCCTAAGTCTGTGGAGTTTCGATGATGCAgaatggttgactctcttttcagggcatctttcatgaccaaaaccgtgccttgtggaaatgaacttcacaaattcctcatctgggacaccgctggccaggagcgggtaagtacatgctacttctggctttctagggacaaaat^taaag^GGAGCCAGCTTCTGCATTAATATACACACATGCATGTACACACACATATACATACACACACGTGCACGCACACACATATACATACACACAAGTGCACAC
This is a 142 bp deletion beginning at Chromosome 17 position 65,717,444 bp and ending after 65,717,585 bp (GRCm38/mm10). There is a 5 bp insertion (TAAAG) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46722 | TGC ATG TGT GTA TAT TAA TGC AGA A | Mutant Reverse | A | |||
| 46723 | TGA GGC TCC TAA GTC TGT GG | Common | A | |||
| 46724 | ATT TCC ACA AGG CAC GGT TT | Wild type Reverse | A | |||
| 46725 | Fluorophore-1 | TTC GAT GAT GCA TAA AGG GAG | Quencher-1 | MUT Probe | ||
| 46726 | Fluorophore-2 | TGG TTG ACT CTC TTT TCA GGG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46722 | 0.40 uM |
| 46723 | 0.40 uM |
| 46724 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.